ZFIN ID: ZDB-MRPHLNO-090126-4
Morpholino Name: MO1-rlbp1a
Target: rlbp1a (1)
Previous Name: cralbp b MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCATAGTGCTCAGATTCTCCACGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rlbp1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rlbp1a
Expressed Gene Anatomy Figures
rlbp1a Fig. 3 from Fleisch et al., 2008
rlbp1b Fig. 3 from Fleisch et al., 2008
PHENOTYPE
Phenotype resulting from MO1-rlbp1a
Phenotype Figures
optokinetic behavior disrupted, abnormal Fig. 7 from Fleisch et al., 2008
pigmentation decreased intensity, abnormal Fig. 5 from Fleisch et al., 2008
response to light intensity decreased occurrence, abnormal Fig. 6 from Fleisch et al., 2008

Phenotype of all Fish created by or utilizing MO1-rlbp1a
Phenotype Fish Conditions Figures
pigmentation decreased intensity, abnormal WT + MO1-rlbp1a standard conditions Fig. 5 from Fleisch et al., 2008
response to light intensity decreased occurrence, abnormal WT + MO1-rlbp1a standard conditions Fig. 6 from Fleisch et al., 2008
optokinetic behavior disrupted, abnormal WT + MO1-rlbp1a standard conditions Fig. 7 from Fleisch et al., 2008
pigmentation decreased intensity, abnormal WT + MO1-rlbp1a + MO1-rlbp1b standard conditions Fig. 5 from Fleisch et al., 2008
response to light intensity decreased occurrence, abnormal WT + MO1-rlbp1a + MO1-rlbp1b standard conditions Fig. 6 from Fleisch et al., 2008
OTHER MO1-rlbp1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)