Morpholino

MO1-fbn2b

ID

ZDB-MRPHLNO-090112-2

Name

MO1-fbn2b

Previous Names

start MO (1)

Target

fbn2b (1)

Sequence

5' - GCGACTCCTGAAGCGCCGGTAAATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fbn2b

No data available

Phenotype

Phenotype resulting from MO1-fbn2b

Phenotype	Fish	Figures
atrium has fewer parts of type atrial endocardium, abnormal	la116Tg + MO1-fbn2b	Fig. 3 from Wang et al., 2013
caudal vein structure, cavities, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	Fig. 10 , text only from Gansner et al., 2008
caudal vein plexus disorganized, abnormal	AB + MO1-fbn2b	Fig. 10 from Gansner et al., 2008
endocardium development decreased process quality, abnormal	la116Tg + MO1-fbn2b	Fig. 3 from Wang et al., 2013
median fin fold attenuate, abnormal	AB + MO1-fbn2b	Fig. 10 from Gansner et al., 2008
melanocyte absent, abnormal	AB + MO1-fbn2b	text only from Gansner et al., 2008
notochord kinked, abnormal	AB + MO1-fbn2b	Fig. 10 from Gansner et al., 2008
trunk edematous, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	Fig. 10 , text only from Gansner et al., 2008
trunk integument distended, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	Fig. 10 from Gansner et al., 2008
whole organism necrotic, abnormal	AB + MO1-fbn2b	text only from Gansner et al., 2008

Phenotype of all Fish created by or utilizing MO1-fbn2b

Phenotype	Fish	Conditions	Figures
trunk edematous, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	standard conditions	Fig. 10 from Gansner et al., 2008
notochord kinked, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	standard conditions	Fig. 10 from Gansner et al., 2008
trunk integument distended, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	standard conditions	Fig. 10 from Gansner et al., 2008
caudal vein plexus disorganized, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	standard conditions	Fig. 10 from Gansner et al., 2008
median fin fold attenuate, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	standard conditions	Fig. 10 from Gansner et al., 2008
caudal vein structure, cavities, abnormal	fbn2b^gw1/gw1 + MO1-fbn2b (AB)	standard conditions	Fig. 10 from Gansner et al., 2008
trunk edematous, abnormal	AB + MO1-fbn2b	standard conditions	Fig. 10 , text only from Gansner et al., 2008
whole organism necrotic, abnormal	AB + MO1-fbn2b	standard conditions	text only from Gansner et al., 2008
median fin fold attenuate, abnormal	AB + MO1-fbn2b	standard conditions	Fig. 10 from Gansner et al., 2008
caudal vein plexus disorganized, abnormal	AB + MO1-fbn2b	standard conditions	Fig. 10 from Gansner et al., 2008
trunk integument distended, abnormal	AB + MO1-fbn2b	standard conditions	Fig. 10 from Gansner et al., 2008
melanocyte absent, abnormal	AB + MO1-fbn2b	standard conditions	text only from Gansner et al., 2008
caudal vein structure, cavities, abnormal	AB + MO1-fbn2b	standard conditions	Fig. 10 , text only from Gansner et al., 2008
notochord kinked, abnormal	AB + MO1-fbn2b	standard conditions	Fig. 10 from Gansner et al., 2008
endocardium development decreased process quality, abnormal	la116Tg + MO1-fbn2b	standard conditions	Fig. 3 from Wang et al., 2013
atrium has fewer parts of type atrial endocardium, abnormal	la116Tg + MO1-fbn2b	standard conditions	Fig. 3 from Wang et al., 2013

Citations