Morpholino

MO1-ak2

ID
ZDB-MRPHLNO-090108-2
Name
MO1-ak2
Previous Names
None
Target
Sequence
5' - CATCCAGCTACAAATGAGAAACAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ak2
Expressed Gene Anatomy Figures
ak2 Fig. 3 from Pannicke et al., 2009
ikzf1 Fig. 3 from Pannicke et al., 2009
lcp1 Fig. S4 from Pannicke et al., 2009
myb Fig. 4 from Rissone et al., 2015
rag1 Fig. S4 from Pannicke et al., 2009
tal1 Fig. 3 from Pannicke et al., 2009
Phenotype
Phenotype resulting from MO1-ak2
Phenotype Fish Figures
blood island apoptotic process increased process quality, abnormal EKW + MO1-ak2 Fig. 5 from Rissone et al., 2015
granulocyte decreased amount, abnormal EKW + MO1-ak2 Fig. 3 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal EKW + MO1-ak2 Fig. 4 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal la2Tg + MO1-ak2 Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal EKW + MO1-ak2 Fig. 5 from Rissone et al., 2015
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal EKW + MO1-ak2 Fig. 5 from Rissone et al., 2015
leukocyte differentiation disrupted, abnormal WT + MO1-ak2 Fig. 3,  Fig. S4 from Pannicke et al., 2009
Phenotype of all Fish created by or utilizing MO1-ak2
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal EKW + MO1-ak2 control Fig. 5 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal EKW + MO1-ak2 control Fig. 4 from Rissone et al., 2015
blood island apoptotic process increased process quality, abnormal EKW + MO1-ak2 control Fig. 5 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal EKW + MO1-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal EKW + MO1-ak2 control Fig. 5 from Rissone et al., 2015
granulocyte decreased amount, abnormal EKW + MO1-ak2 control Fig. 3 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
granulocyte decreased amount, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 3 from Rissone et al., 2015
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 5 from Rissone et al., 2015
blood island apoptotic process increased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 5 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 5 from Rissone et al., 2015
leukocyte differentiation disrupted, abnormal WT + MO1-ak2 standard conditions Fig. 3,  Fig. S4 from Pannicke et al., 2009
hematopoietic stem cell differentiation decreased process quality, abnormal la2Tg + MO1-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal la2Tg + MO1-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal la2Tg + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal la2Tg + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.