header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090107-2
Morpholino Name: MO3-kdrl
Target: kdrl (1)
Previous Name: flk1 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTTTAAGAGGAGTCATTTTGTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-kdrl No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-kdrl
Expressed Gene Anatomy Figures
efnb2a Fig. 3 from Minehata et al., 2008
fli1a Fig. 3 from Minehata et al., 2008
flt4 Fig. 3 from Minehata et al., 2008
PHENOTYPE
Phenotype resulting from MO3-kdrl
Phenotype of all Fish created by or utilizing MO3-kdrl
Genome Resources:
CITATIONS (2)