Morpholino

MO3-atp1b2b

ID

ZDB-MRPHLNO-081231-6

Name

MO3-atp1b2b

Previous Names

MO1B3b (1)

Target

atp1b2b (1)

Sequence

5' - AGCTAGTCTTACCCCAACTGCTCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-atp1b2b

No data available

Phenotype

Phenotype resulting from MO3-atp1b2b

Phenotype	Fish	Figures
cardiac ventricle decreased size, abnormal	AB + MO3-atp1b2b	Fig. 7 from Wang et al., 2008
heart contraction decreased rate, abnormal	AB + MO3-atp1b2b	Fig. 7 from Wang et al., 2008
inner ear morphogenesis disrupted, abnormal	AB + MO3-atp1b2b	Fig. 3 , Fig. 7 from Wang et al., 2008
otic vesicle decreased size, abnormal	AB + MO3-atp1b2b	Fig. 3 from Wang et al., 2008
otic vesicle shape, abnormal	AB + MO3-atp1b2b	Fig. 3 , Fig. 7 from Wang et al., 2008
otolith decreased amount, abnormal	AB + MO3-atp1b2b	Fig. 7 from Wang et al., 2008
otolith protruding, abnormal	AB + MO3-atp1b2b	Fig. 7 from Wang et al., 2008
pericardium edematous, abnormal	AB + MO3-atp1b2b	Fig. 7 from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal	AB + MO3-atp1b2b	Fig. 3 from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal	AB + MO3-atp1b2b	Fig. 3 from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal	AB + MO3-atp1b2b	Fig. 3 from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	AB + MO3-atp1b2b	Fig. 7 from Wang et al., 2008
semicircular canal malformed, abnormal	AB + MO3-atp1b2b	Fig. 3 from Wang et al., 2008
startle response disrupted, abnormal	AB + MO3-atp1b2b	Fig. 7 from Wang et al., 2008

Phenotype of all Fish created by or utilizing MO3-atp1b2b

Phenotype	Fish	Conditions	Figures
inner ear morphogenesis disrupted, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 3 , Fig. 7 from Wang et al., 2008
pericardium edematous, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 7 from Wang et al., 2008
otic vesicle decreased size, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 3 from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 3 from Wang et al., 2008
otolith protruding, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 7 from Wang et al., 2008
cardiac ventricle decreased size, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 7 from Wang et al., 2008
heart contraction decreased rate, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 7 from Wang et al., 2008
otolith decreased amount, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 7 from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 7 from Wang et al., 2008
startle response disrupted, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 7 from Wang et al., 2008
otic vesicle shape, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 3 , Fig. 7 from Wang et al., 2008
semicircular canal malformed, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 3 from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 3 from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal	AB + MO3-atp1b2b	standard conditions	Fig. 3 from Wang et al., 2008

Citations