header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081231-6
Morpholino Name: MO3-atp1b2b
Target: atp1b2b (1)
Previous Name: MO1B3b (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTAGTCTTACCCCAACTGCTCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-atp1b2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-atp1b2b No data available
PHENOTYPE
Phenotype resulting from MO3-atp1b2b
Phenotype of all Fish created by or utilizing MO3-atp1b2b
Phenotype Fish Conditions Figures
inner ear morphogenesis disrupted, abnormal AB + MO3-atp1b2b standard conditions Fig. 3 with imageFig. 7 with image from Wang et al., 2008
pericardium edematous, abnormal AB + MO3-atp1b2b standard conditions Fig. 7 with image from Wang et al., 2008
otic vesicle decreased size, abnormal AB + MO3-atp1b2b standard conditions Fig. 3 with image from Wang et al., 2008
otolith protruding, abnormal AB + MO3-atp1b2b standard conditions Fig. 7 with image from Wang et al., 2008
cardiac ventricle decreased size, abnormal AB + MO3-atp1b2b standard conditions Fig. 7 with image from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal AB + MO3-atp1b2b standard conditions Fig. 3 with image from Wang et al., 2008
heart contraction decreased rate, abnormal AB + MO3-atp1b2b standard conditions Fig. 7 with image from Wang et al., 2008
otolith decreased amount, abnormal AB + MO3-atp1b2b standard conditions Fig. 7 with image from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal AB + MO3-atp1b2b standard conditions Fig. 7 with image from Wang et al., 2008
startle response disrupted, abnormal AB + MO3-atp1b2b standard conditions Fig. 7 with image from Wang et al., 2008
otic vesicle shape, abnormal AB + MO3-atp1b2b standard conditions Fig. 3 with imageFig. 7 with image from Wang et al., 2008
semicircular canal malformed, abnormal AB + MO3-atp1b2b standard conditions Fig. 3 with image from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal AB + MO3-atp1b2b standard conditions Fig. 3 with image from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal AB + MO3-atp1b2b standard conditions Fig. 3 with image from Wang et al., 2008
Genome Resources:
CITATIONS (1)