ZFIN ID: ZDB-MRPHLNO-081222-1
Morpholino Name: MO1-s1pr1
Target: s1pr1 (1)
Previous Name: edg1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTAGGTCATCCATGGTTTGCACTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-s1pr1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-s1pr1
Expressed Gene Anatomy Figures
ctslb Fig. 6 with image from Kai et al., 2008
dlx3b Fig. 6 with imageFig. S3 with image from Kai et al., 2008
hlx1 Fig. 6 with image from Kai et al., 2008
nkx2.4b Fig. S3 with image from Kai et al., 2008
pax2a Fig. S3 with image from Kai et al., 2008
tbxta Fig. 6 with image from Kai et al., 2008
PHENOTYPE
Phenotype resulting from MO1-s1pr1
Phenotype Figures
cell migration involved in gastrulation disrupted, abnormal Fig. S3 with image from Kai et al., 2008
hypoblast mesodermal cell decreased speed, abnormal Fig. 6 with image from Kai et al., 2008
mesodermal cell migration decreased rate, abnormal Fig. 6 with image from Kai et al., 2008
neural keel decreased length, abnormal Fig. S3 with image from Kai et al., 2008
prechordal plate decreased length, abnormal Fig. 6 with image from Kai et al., 2008

Phenotype of all Fish created by or utilizing MO1-s1pr1
Phenotype Fish Conditions Figures
prechordal plate decreased length, abnormal WT + MO1-s1pr1 standard conditions Fig. 6 with image from Kai et al., 2008
mesodermal cell migration decreased rate, abnormal WT + MO1-s1pr1 standard conditions Fig. 6 with image from Kai et al., 2008
cell migration involved in gastrulation disrupted, abnormal WT + MO1-s1pr1 standard conditions Fig. S3 with image from Kai et al., 2008
hypoblast mesodermal cell decreased speed, abnormal WT + MO1-s1pr1 standard conditions Fig. 6 with image from Kai et al., 2008
neural keel decreased length, abnormal WT + MO1-s1pr1 standard conditions Fig. S3 with image from Kai et al., 2008
prechordal plate decreased length, abnormal wnt11tx226/tx226 + MO1-s1pr1 standard conditions Fig. 6 with image from Kai et al., 2008
cell migration involved in gastrulation disrupted, abnormal wnt11tx226/tx226 + MO1-s1pr1 standard conditions Fig. 6 with image from Kai et al., 2008
OTHER MO1-s1pr1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)