header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081209-3
Morpholino Name: MO3-mpp5a
Target: mpp5a (1)
Sequence:
5' - TCAGCAGCGGCTCCAGACACTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-mpp5a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-mpp5a No data available
PHENOTYPE
Phenotype resulting from MO3-mpp5a
Phenotype of all Fish created by or utilizing MO3-mpp5a
OTHER MO3-mpp5a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)