ZFIN ID: ZDB-MRPHLNO-081125-4
Morpholino Name: MO1-exorh
Target: exorh (1)
Previous Name: exorh atg MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGTTGGGTCCCTCCGTCCCGTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-blocker
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-exorh No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-exorh
Expressed Gene Anatomy Figures
aanat2 Fig. 5 from Pierce et al., 2008
exorh Fig. S1 with image from Noche et al., 2011
Fig. 4Fig. 5Fig. S1 from Pierce et al., 2008
opn1lw1 Fig. 5 from Pierce et al., 2008
PHENOTYPE
Phenotype resulting from MO1-exorh
Phenotype of all Fish created by or utilizing MO1-exorh
Genome Resources:
CITATIONS (2)