header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081120-2
Morpholino Name: MO2-barx1
Target: barx1 (1)
Previous Name: Sa MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCTTCAGAACTGGAATGAAATAAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets splice acceptor of the second exon of barx1.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-barx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-barx1 No data available
PHENOTYPE
Phenotype resulting from MO2-barx1
Phenotype of all Fish created by or utilizing MO2-barx1
Phenotype Fish Conditions Figures
odontogenesis paedomorphic growth, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with imageFig. S5 with image from Sperber et al., 2008
ceratobranchial 5 tooth decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
pharyngeal arch mesenchyme morphology, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 7 with image from Sperber et al., 2008
mandibular arch skeleton decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
head decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
cartilage development disrupted, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 3 with imageFig. 5 with imageFig. 7 with image from Sperber et al., 2008
pharyngeal arch decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
embryonic skeletal joint morphogenesis process quality, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 6 with image from Sperber et al., 2008
ceratobranchial 5 tooth immature, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. S5 with image from Sperber et al., 2008
embryo development delayed, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 4 with image from Sperber et al., 2008
cell population proliferation decreased rate, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 7 with image from Sperber et al., 2008
mandibular arch skeleton decreased size, abnormal EKW + MO2-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
cartilage development disrupted, abnormal EKW + MO2-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
OTHER MO2-barx1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)