header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081120-1
Morpholino Name: MO1-barx1
Target: barx1 (1)
Previous Name: Bx MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCCCAATCTCCAAAGGATGTTGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the translational start site of barx1.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-barx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-barx1 No data available
PHENOTYPE
Phenotype resulting from MO1-barx1
Phenotype of all Fish created by or utilizing MO1-barx1
Phenotype Fish Conditions Figures
pharyngeal arch decreased size, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
cartilage development disrupted, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with imageFig. S4 with image from Sperber et al., 2008
head decreased size, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
pharyngeal arch cartilage chondroblast disorganized, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with imageFig. S4 with image from Sperber et al., 2008
chondroblast extracellular matrix absent, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with imageFig. S4 with image from Sperber et al., 2008
pharyngeal arch morphology, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
ceratobranchial cartilage aplastic, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
mandibular arch skeleton decreased size, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
embryonic skeletal joint morphogenesis disrupted, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
odontogenesis paedomorphic growth, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with imageFig. S5 with image from Sperber et al., 2008
ceratobranchial 5 tooth decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
pharyngeal arch mesenchyme morphology, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 7 with image from Sperber et al., 2008
mandibular arch skeleton decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
head decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
cartilage development disrupted, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 3 with imageFig. 5 with imageFig. 7 with image from Sperber et al., 2008
pharyngeal arch decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
embryonic skeletal joint morphogenesis process quality, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 6 with image from Sperber et al., 2008
ceratobranchial 5 tooth immature, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. S5 with image from Sperber et al., 2008
embryo development delayed, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 4 with image from Sperber et al., 2008
cell population proliferation decreased rate, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 7 with image from Sperber et al., 2008
cartilage development delayed, abnormal y1Tg + MO1-barx1 standard conditions Fig. S4 with image from Sperber et al., 2008
OTHER MO1-barx1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)