ZFIN ID: ZDB-MRPHLNO-081107-2
Morpholino Name: MO3-dld
Target: dld (1)
Sequence:
5' - AACAGCTATCATTAGTCGTCCCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-dld No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-dld
Expressed Gene Anatomy Figures
mespba Fig. 1 from Kawamura et al., 2008
PHENOTYPE
Phenotype resulting from MO3-dld
No data available

Phenotype of all Fish created by or utilizing MO3-dld
No data available
OTHER MO3-dld MORPHOLINO PAGESNo links to external sites
CITATIONS (3)