Morpholino

MO2-dld

ID
ZDB-MRPHLNO-081030-1
Name
MO2-dld
Previous Names
  • deltaD-MO (1)
Target
Sequence
5' - AAACAGCTATCATTAGTCGTCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dld
Expressed Gene Anatomy Figures
foxc1b Fig. 6 from Kim et al., 2014
myb Fig. 5 from Lee et al., 2014
Fig. 3 from Clements et al., 2011
neurod1 Fig. 2 from Mizoguchi et al., 2011
rag1 Fig. 3 from Clements et al., 2011
runx1 Fig. 6 from Kim et al., 2014
Fig. 5 from Lee et al., 2014
Fig. 3 from Clements et al., 2011
twist1b Fig. 6 from Kim et al., 2014
Phenotype
Phenotype resulting from MO2-dld
Phenotype Fish Figures
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO2-dld Fig. 6 from Kim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO2-dld Fig. 3 from Clements et al., 2011
hematopoietic stem cell differentiation disrupted, abnormal WT + MO2-dld Fig. 3 from Clements et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-dld Fig. 2 with image from Lopes et al., 2010
posterior lateral line ganglion neuron decreased amount, abnormal WT + MO2-dld Fig. 2 from Mizoguchi et al., 2011
sclerotome development process quality, abnormal AB + MO2-dld Fig. 6 from Kim et al., 2014
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO2-dld Fig. 5 from Lee et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO2-dld Fig. 5 from Lee et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal AB + MO2-dld Fig. 5 from Lee et al., 2014
Phenotype of all Fish created by or utilizing MO2-dld
Phenotype Fish Conditions Figures
sclerotome development process quality, abnormal AB + MO2-dld standard conditions Fig. 6 from Kim et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal AB + MO2-dld standard conditions Fig. 5 from Lee et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO2-dld standard conditions Fig. 5 from Lee et al., 2014
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO2-dld standard conditions Fig. 5 from Lee et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO2-dld standard conditions Fig. 6 from Kim et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-dld standard conditions Fig. 2 with image from Lopes et al., 2010
hematopoietic stem cell decreased amount, abnormal WT + MO2-dld standard conditions Fig. 3 from Clements et al., 2011
posterior lateral line ganglion neuron decreased amount, abnormal WT + MO2-dld standard conditions Fig. 2 from Mizoguchi et al., 2011
hematopoietic stem cell differentiation disrupted, abnormal WT + MO2-dld standard conditions Fig. 3 from Clements et al., 2011
hematopoietic stem cell differentiation disrupted, abnormal dlctit446/tit446 + MO2-dld standard conditions Fig. 3 from Clements et al., 2011
thymus T cell absent, abnormal dlctit446/tit446 + MO2-dld standard conditions Fig. 3 from Clements et al., 2011
hematopoietic stem cell absent, abnormal dlctit446/tit446 + MO2-dld standard conditions Fig. 3 from Clements et al., 2011
somite specification disrupted, abnormal fbxo5tiy121/tiy121 + MO2-dld standard conditions Fig. S1 with image from Zhang et al., 2008
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, exacerbated pd1Tg/+ + MO2-dld (AB) heat shock Fig. 5 from Lee et al., 2014
ventral wall of dorsal aorta myb expression decreased amount, abnormal pd1Tg/+ + MO2-dld (AB) heat shock Fig. 5 from Lee et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal pd1Tg/+ + MO2-dld (AB) heat shock Fig. 5 from Lee et al., 2014
sclerotome development process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
posterior lateral line ganglion neuron decreased amount, abnormal WT + MO2-dld + MO3-dlb standard conditions Fig. 2 from Mizoguchi et al., 2011
posterior lateral line ganglion neuron decreased amount, abnormal dlankhspGFFDMC72AEt + MO2-dld standard conditions Fig. 2 from Mizoguchi et al., 2011
CiD increased amount, abnormal nns5Tg + MO2-dld + MO4-dla standard conditions Fig. 3 with image from Okigawa et al., 2014
VeLD increased amount, abnormal nns5Tg + MO2-dld + MO4-dla standard conditions Fig. 3 with image from Okigawa et al., 2014
posterior lateral line ganglion neuron increased amount, abnormal dlankhspGFFDMC72AEt + MO2-dld + MO3-dlb standard conditions Fig. 2 from Mizoguchi et al., 2011
CiD increased amount, abnormal nns5Tg + MO2-dlc + MO2-dld + MO4-dla standard conditions Fig. 3 with image from Okigawa et al., 2014
VeLD increased amount, abnormal nns5Tg + MO2-dlc + MO2-dld + MO4-dla standard conditions Fig. 3 with image from Okigawa et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.