header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081015-1
Morpholino Name: MO1-pou5f3
Target: pou5f3 (1)
Previous Names: MO-pou2 (1), MO1-pou5f1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCTCTCTCCGTCATCTTTCCGCTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pou5f3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pou5f3
Expressed Gene Anatomy Figures
aicda Fig. 3 with image from Rai et al., 2010
gadd45ab Fig. 3 with image from Rai et al., 2010
mbd4 Fig. 3 with image from Rai et al., 2010
PHENOTYPE
Phenotype resulting from MO1-pou5f3
Phenotype of all Fish created by or utilizing MO1-pou5f3
OTHER MO1-pou5f3 MORPHOLINO PAGESNo links to external sites
CITATIONS (8)