header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081013-2
Morpholino Name: MO2-ccn2a
Target: ccn2a (1)
Previous Names: MO2-ctgf, MO2-ctgfa

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAGATCCTACAAAGTCTTCTCTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ccn2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ccn2a No data available
PHENOTYPE
Phenotype resulting from MO2-ccn2a
Phenotype of all Fish created by or utilizing MO2-ccn2a
OTHER MO2-ccn2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)