Morpholino

MO1-brpf1

ID

ZDB-MRPHLNO-080925-1

Name

MO1-brpf1

Previous Names

None

Target

brpf1 (1)

Sequence

5' - GTAAGTGCAGTACCTGTAGTAGCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-brpf1

Expressed Gene	Anatomy	Figures
hoxa2b	pharyngeal arch 2 pharyngeal arch 3-7 rhombomere 2 rhombomere 3 rhombomere 4 rhombomere 5	Fig. 4 from Laue et al., 2008
hoxb2a	neuroectoderm	Fig. S6 from Laue et al., 2008
nkx3-2	pharyngeal arch 1	Fig. 4 from Laue et al., 2008

Phenotype

Phenotype resulting from MO1-brpf1

Phenotype	Fish	Figures
basihyal bone aplastic, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
basihyal bone decreased size, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
ceratobranchial bone increased width, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
ceratohyal bone inverted, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
ceratohyal bone morphology, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
ceratohyal bone shape, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
hyomandibula decreased size, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
hyosymplectic cartilage shape, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
hypobranchial bone aplastic, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
Meckel's cartilage shape, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
palatoquadrate cartilage shape, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
pharyngeal arch 2 skeleton bifurcated, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
pharyngeal arch 2 skeleton decreased length, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
pharyngeal arch 2 skeleton increased width, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008
symplectic decreased length, abnormal	WT + MO1-brpf1	Fig. T1 from Laue et al., 2008

Phenotype of all Fish created by or utilizing MO1-brpf1

Phenotype	Fish	Conditions	Figures
ceratohyal bone shape, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
symplectic decreased length, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
basihyal bone decreased size, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
hypobranchial bone aplastic, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
palatoquadrate cartilage shape, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
pharyngeal arch 2 skeleton decreased length, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
ceratobranchial bone increased width, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
ceratohyal bone morphology, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
Meckel's cartilage shape, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
hyomandibula decreased size, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
basihyal bone aplastic, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
pharyngeal arch 2 skeleton bifurcated, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
ceratohyal bone inverted, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
pharyngeal arch 2 skeleton increased width, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
hyosymplectic cartilage shape, abnormal	WT + MO1-brpf1	standard conditions	Fig. T1 from Laue et al., 2008
basihyal bone aplastic, abnormal	WT + MO1-brpf1 + MO3-kat6a	standard conditions	Fig. S6 from Laue et al., 2008

Citations