ZFIN ID: ZDB-MRPHLNO-080915-1
Morpholino Name: MO1-prrc1
Target: prrc1 (1)
Previous Name: mys-ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTCCATCATCTTCACTCTGTTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-prrc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-prrc1
Expressed Gene Anatomy Figures
en1a Fig. 5Fig. 6 from Kotani et al., 2010
foxa Fig. 5Fig. 6 from Kotani et al., 2010
pax2a Fig. 5Fig. 6 from Kotani et al., 2010
pax6a Fig. 5 from Kotani et al., 2010
prkar1aa Fig. 4 from Kotani et al., 2010
prrc1 Fig. 4 from Kotani et al., 2010
ptch2 Fig. 5Fig. 6 from Kotani et al., 2010
twist2 Fig. 5 from Kotani et al., 2010
PHENOTYPE
Phenotype resulting from MO1-prrc1
Phenotype Figures
cell lamellipodium decreased amount, abnormal Fig. 9 with image from Kotani et al., 2008
epithelial structure maintenance disrupted, abnormal Fig. 5 with imageFig. 6 with image from Kotani et al., 2008
formation of anatomical boundary delayed, abnormal Fig. 4 with image from Kotani et al., 2008
protein kinase activity decreased occurrence, abnormal Fig. 4 from Kotani et al., 2010
somite morphology, abnormal Fig. 4 with image from Kotani et al., 2008
somite actin cytoskeleton disorganized, abnormal Fig. 6 with image from Kotani et al., 2008
somite epithelial cell morphology, abnormal Fig. 5 with image from Kotani et al., 2008
somite laminin complex decreased amount, abnormal Fig. 6 with image from Kotani et al., 2008
trunk musculature disorganized, abnormal Fig. 7 with image from Kotani et al., 2008
whole organism curved ventral, abnormal Fig. 4 with image from Kotani et al., 2008

Phenotype of all Fish created by or utilizing MO1-prrc1
Phenotype Fish Conditions Figures
protein kinase activity decreased occurrence, abnormal TL + MO1-prrc1 standard conditions Fig. 4 from Kotani et al., 2010
whole organism curved ventral, abnormal WT + MO1-prrc1 standard conditions Fig. 4 with image from Kotani et al., 2008
somite actin cytoskeleton disorganized, abnormal WT + MO1-prrc1 standard conditions Fig. 6 with image from Kotani et al., 2008
somite laminin complex decreased amount, abnormal WT + MO1-prrc1 standard conditions Fig. 6 with image from Kotani et al., 2008
formation of anatomical boundary delayed, abnormal WT + MO1-prrc1 standard conditions Fig. 4 with image from Kotani et al., 2008
cell lamellipodium decreased amount, abnormal WT + MO1-prrc1 standard conditions Fig. 9 with image from Kotani et al., 2008
epithelial structure maintenance disrupted, abnormal WT + MO1-prrc1 standard conditions Fig. 5 with imageFig. 6 with image from Kotani et al., 2008
somite morphology, abnormal WT + MO1-prrc1 standard conditions Fig. 4 with image from Kotani et al., 2008
somite epithelial cell morphology, abnormal WT + MO1-prrc1 standard conditions Fig. 5 with image from Kotani et al., 2008
trunk musculature disorganized, abnormal nksagm011dGt + MO1-prrc1 standard conditions Fig. 7 with image from Kotani et al., 2008
OTHER MO1-prrc1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)