ZFIN ID: ZDB-MRPHLNO-080911-3
Morpholino Name: MO4-pax3a
Target: pax3a (1)
Previous Names: MO4-pax3 (1), pax3 MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAAGGATGCACGAAGCACTTGATAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-pax3a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-pax3a
Expressed Gene Anatomy Figures
aox5 Fig. 3 with imagetext only from Minchin et al., 2008
csf1ra Fig. 3 with image from Minchin et al., 2008
dct Fig. 7 with image from Minchin et al., 2008
gch2 Fig. 3 with image from Minchin et al., 2008
mitfa Fig. 3 with image from Minchin et al., 2008
pax7a Fig. 3 with image from Minchin et al., 2008
PHENOTYPE
Phenotype resulting from MO4-pax3a
Phenotype Figures
head xanthophore decreased amount, abnormal Fig. 3 with image from Minchin et al., 2008
melanocyte differentiation delayed, abnormal Fig. 7 with image from Minchin et al., 2008
trunk xanthophore absent, abnormal Fig. 3 with image from Minchin et al., 2008
xanthophore differentiation disrupted, abnormal Fig. 3 with image from Minchin et al., 2008

Phenotype of all Fish created by or utilizing MO4-pax3a
Phenotype Fish Conditions Figures
melanocyte differentiation delayed, abnormal WT + MO4-pax3a standard conditions Fig. 7 with image from Minchin et al., 2008
xanthophore differentiation disrupted, abnormal WT + MO4-pax3a standard conditions Fig. 3 with image from Minchin et al., 2008
head xanthophore decreased amount, abnormal WT + MO4-pax3a standard conditions Fig. 3 with image from Minchin et al., 2008
trunk xanthophore absent, abnormal WT + MO4-pax3a standard conditions Fig. 3 with image from Minchin et al., 2008
OTHER MO4-pax3a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)