header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080814-1
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.
Morpholino Name: MO1-pdx1
Target: pdx1 (1)
Sequence:
5' - GATAGTAATGCTCTTCCCGATTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pdx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pdx1
Expressed Gene Anatomy Figures
elmo1 Fig. 2 with image from Sharma et al., 2016
ins Fig. 1 with image from Kimmel et al., 2011
PHENOTYPE
Phenotype resulting from MO1-pdx1
Phenotype Figures
acinar cell decreased amount, abnormal Fig. 1 from Yee et al., 2001
blood vessel increased branchiness, abnormal Fig. 2 from Jörgens et al., 2015
blood vessel morphology, abnormal Fig. 2 from Jörgens et al., 2015
determination of digestive tract left/right asymmetry process quality, abnormal Fig. 1 from Yee et al., 2001
determination of liver left/right asymmetry process quality, abnormal Fig. 1 from Yee et al., 2001
determination of pancreatic left/right asymmetry process quality, abnormal Fig. 1 from Yee et al., 2001
digestive system positional polarity, abnormal Fig. 1 from Yee et al., 2001
endocrine pancreas EGFP expression decreased distribution, abnormal Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased functionality, abnormal Fig. 1 from Yee et al., 2001
endocrine pancreas decreased size, abnormal Fig. S10 from O'Hare et al., 2016
Fig. 3 with image from Kimmel et al., 2011
Fig. 1 from Yee et al., 2001
endocrine pancreas has fewer parts of type endodermal cell, abnormal Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas hypoplastic, abnormal Fig. 6 from Jurczyk et al., 2011
endocrine pancreas development disrupted, abnormal Fig. S10 from O'Hare et al., 2016
Fig. 1 with image,  Fig. 3 with image from Kimmel et al., 2011
enteroendocrine cell differentiation disrupted, abnormal Fig. S10 from O'Hare et al., 2016
exocrine pancreas hypoplastic, abnormal Fig. 1 from Yee et al., 2001
glucose homeostasis disrupted, abnormal Fig. S15 from O'Hare et al., 2016
glucose metabolic process disrupted, abnormal Fig. 6 from Jurczyk et al., 2011
intersegmental vessel morphology, abnormal Fig. 2 from Jörgens et al., 2015
intersegmental vessel structure, abnormal Fig. 2 from Jörgens et al., 2015
pancreatic B cell decreased amount, abnormal Fig. 2 from O'Hare et al., 2016
Fig. 1 with image,  Fig. 3 with image from Kimmel et al., 2011
posterior pancreatic bud decreased size, abnormal Fig. 1 with image from Kimmel et al., 2011
pronephric glomerulus increased size, abnormal Fig. 7 with image from She et al., 2017
pronephric glomerulus increased width, abnormal Fig. 3 with image,  Fig. 6 with image from Sharma et al., 2016
pronephric podocyte glomerular visceral epithelial cell development decreased process quality, abnormal Fig. 5 with image from Sharma et al., 2016
pronephric podocyte podocyte foot dystrophic, abnormal Fig. 5 with image from Sharma et al., 2016
pronephric podocyte podocyte foot malformed, abnormal Fig. 5 with image from Sharma et al., 2016
pronephric tubule decreased length, abnormal Fig. 7 with image from She et al., 2017
Fig. 3 with image,  Fig. 6 with image from Sharma et al., 2016
pronephros renal filtration decreased occurrence, abnormal Fig. 7 with image from She et al., 2017
Fig. 6 with image from Sharma et al., 2016
pronephros morphogenesis decreased process quality, abnormal Fig. 3 with image,  Fig. 6 with image from Sharma et al., 2016
type B pancreatic cell differentiation disrupted, abnormal Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal Fig. 3 with image from Kimmel et al., 2011

Phenotype of all Fish created by or utilizing MO1-pdx1
Phenotype Fish Conditions Figures
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
pancreatic B cell decreased amount, abnormal WT + MO1-pdx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
posterior pancreatic bud decreased size, abnormal WT + MO1-pdx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
determination of liver left/right asymmetry process quality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
endocrine pancreas decreased functionality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
acinar cell decreased amount, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
endocrine pancreas development disrupted, abnormal WT + MO1-pdx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
exocrine pancreas hypoplastic, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
endocrine pancreas decreased size, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
digestive system positional polarity, abnormal WT + MO1-pdx1 standard conditions Fig. 1 from Yee et al., 2001
pronephric tubule decreased length, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric glomerulus increased width, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 3 with image,  Fig. 6 with image from Sharma et al., 2016
pronephros renal filtration decreased occurrence, abnormal li1Tg + MO1-pdx1 control Fig. 7 with image from She et al., 2017
Fig. 6 with image from Sharma et al., 2016
pronephric glomerulus increased width, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric tubule decreased length, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 7 with image from She et al., 2017
Fig. 3 with image,  Fig. 6 with image from Sharma et al., 2016
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 3 with image,  Fig. 6 with image from Sharma et al., 2016
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric podocyte glomerular visceral epithelial cell development decreased process quality, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 5 with image from Sharma et al., 2016
pronephric glomerulus increased size, abnormal li1Tg + MO1-pdx1 control Fig. 7 with image from She et al., 2017
pronephric podocyte podocyte foot malformed, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 5 with image from Sharma et al., 2016
pronephros renal filtration decreased occurrence, abnormal li1Tg + MO1-pdx1 chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from Sharma et al., 2016
pronephric podocyte podocyte foot dystrophic, abnormal li1Tg + MO1-pdx1 standard conditions Fig. 5 with image from Sharma et al., 2016
endocrine pancreas decreased size, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas EGFP expression decreased distribution, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-pdx1 standard conditions Fig. S10 from O'Hare et al., 2016
blood vessel morphology, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel morphology, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
intersegmental vessel structure, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
blood vessel increased branchiness, abnormal y1Tg + MO1-pdx1 + MO4-tp53 standard conditions Fig. 2 from Jörgens et al., 2015
endocrine pancreas hypoplastic, abnormal zf5Tg + MO1-pdx1 standard conditions Fig. 6 from Jurczyk et al., 2011
glucose metabolic process disrupted, abnormal zf5Tg + MO1-pdx1 standard conditions Fig. 6 from Jurczyk et al., 2011
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-pdx1 chemical treatment by environment: glucose Fig. S15 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-pdx1 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-pdx1 control Fig. S15 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-pdx1 standard conditions Fig. 2 from O'Hare et al., 2016
response to glucose decreased process quality, abnormal jh1Tg; jh2Tg + MO1-pdx1 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas decreased size, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type endodermal cell, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
pancreatic B cell absent, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal WT + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 1 with image from Kimmel et al., 2011
pronephros renal filtration occurrence, ameliorated li1Tg + MO1-epoa + MO1-pdx1 control Fig. 7 with image from She et al., 2017
pronephric glomerulus increased size, exacerbated li1Tg + MO1-epoa + MO1-pdx1 control Fig. 7 with image from She et al., 2017
pronephric tubule decreased length, exacerbated li1Tg + MO1-epoa + MO1-pdx1 control Fig. 7 with image from She et al., 2017
posterior pancreatic bud elongated, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
posterior pancreatic bud cellular motility, abnormal nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
type B pancreatic cell differentiation absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
endocrine pancreas has fewer parts of type endodermal cell, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
type B pancreatic cell proliferation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas development disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image from Kimmel et al., 2011
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
pancreatic B cell absent, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 2 with image,  Fig. 3 with image from Kimmel et al., 2011
endocrine pancreas decreased size, abnormal m1018Tg; nl1Tg + MO1-pdx1 + MO2-mnx1 standard conditions Fig. 3 with image from Kimmel et al., 2011
Genome Resources:
CITATIONS (11)