header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080808-5
Morpholino Name: MO1-cdkn1a
Target: cdkn1a (1)
Previous Name: p21MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAATAAAGAGGTCTGACCTGTGATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets a splice donor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cdkn1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cdkn1a
Expressed Gene Anatomy Figures
rela Fig. 4 from Liu et al., 2009
snai1a Fig. 5 from Liu et al., 2009
sox32 Fig. 6 from Liu et al., 2009
PHENOTYPE
Phenotype resulting from MO1-cdkn1a
Phenotype of all Fish created by or utilizing MO1-cdkn1a
OTHER MO1-cdkn1a MORPHOLINO PAGES No links to external sites
CITATIONS (5)