ZFIN ID: ZDB-MRPHLNO-080724-3
Morpholino Name: MO1-ift20
Target: ift20 (1)
Previous Name: ift20-SP (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAACAACGTACCTTCATTTTTTCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ift20 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ift20
Expressed Gene Anatomy Figures
ift20 Fig. S3 from Omori et al., 2008
PHENOTYPE
Phenotype resulting from MO1-ift20
Phenotype Figures
developmental growth decreased rate, abnormal Fig. S3 from Omori et al., 2008
olfactory pit cilium decreased amount, abnormal Fig. S3 from Omori et al., 2008
otic vesicle cilium decreased amount, abnormal Fig. S3 from Omori et al., 2008
post-vent region curved ventral, abnormal Fig. S3 from Omori et al., 2008
pronephric duct cilium decreased amount, abnormal Fig. S3 from Omori et al., 2008

Phenotype of all Fish created by or utilizing MO1-ift20
Phenotype Fish Conditions Figures
developmental growth decreased rate, abnormal WT + MO1-ift20 standard conditions Fig. S3 from Omori et al., 2008
olfactory pit cilium decreased amount, abnormal WT + MO1-ift20 standard conditions Fig. S3 from Omori et al., 2008
otic vesicle cilium decreased amount, abnormal WT + MO1-ift20 standard conditions Fig. S3 from Omori et al., 2008
post-vent region curved ventral, abnormal WT + MO1-ift20 standard conditions Fig. S3 from Omori et al., 2008
pronephric duct cilium decreased amount, abnormal WT + MO1-ift20 standard conditions Fig. S3 from Omori et al., 2008
pronephros cystic, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
pericardium edematous, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
OTHER MO1-ift20 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)