header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080721-3
Morpholino Name: MO1-churc1
Target: churc1 (1)
Sequence:
5' - GCTTCTGGACACAACCGGTACACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-churc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-churc1
Expressed Gene Anatomy Figures
chrd Fig. 2 with image from Londin et al., 2007
gata2a Fig. 3 with image from Londin et al., 2007
hoxb1b Fig. 3 with image from Londin et al., 2007
mixl1 Fig. 3 with image from Londin et al., 2007
noto Fig. 2 with imageFig. 3 with image from Londin et al., 2007
otx2b Fig. 3 with image from Londin et al., 2007
six3a Fig. 3 with image from Londin et al., 2007
sox3 Fig. 3 with image from Londin et al., 2007
sox17 Fig. 3 with image from Londin et al., 2007
tbx16 Fig. 2 with imageFig. 3 with image from Londin et al., 2007
tbx16l Fig. 3 with image from Londin et al., 2007
tbxta Fig. 2 with imageFig. 3 with image from Londin et al., 2007
zeb2b Fig. 2 with image from Londin et al., 2007
PHENOTYPE
Phenotype resulting from MO1-churc1
Phenotype of all Fish created by or utilizing MO1-churc1
OTHER MO1-churc1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)