header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080717-2
Morpholino Name: MO3-tcf7l1b
Target: tcf7l1b (1)
Sequence:
5' - CATCCCTGATTGGCTTACGTGTTAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-tcf7l1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-tcf7l1b
Expressed Gene Anatomy Figures
tcf7l1b Fig. 1 with image from Gribble et al., 2009
PHENOTYPE
Phenotype resulting from MO3-tcf7l1b
No data available

Phenotype of all Fish created by or utilizing MO3-tcf7l1b
OTHER MO3-tcf7l1b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)