ZFIN ID: ZDB-MRPHLNO-080707-4
Morpholino Name: MO3-myf6
Target: myf6 (1)
Previous Name: mrf4 MO3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATTAATAAAGGGACTAAGACGACAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino that targets myf6.
TARGET LOCATIONS
View all 97 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-myf6 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-myf6
Expressed Gene Anatomy Figures
actc1b Fig. 4 with image from Wang et al., 2008
alcama Fig. 6 with image from Wang et al., 2008
tnnt2c Fig. 4 with image from Wang et al., 2008
tnnt3b Fig. 4 with image from Wang et al., 2008
PHENOTYPE
Phenotype resulting from MO3-myf6
Phenotype Figures
axonogenesis disrupted, abnormal Fig. 6 with image from Wang et al., 2008
somite U-shaped, abnormal Fig. 4 with image from Wang et al., 2008
somite myofibril misaligned with somite myofibril, abnormal Fig. 3 with imageFig. 4 with image from Wang et al., 2008
trunk curved ventral, abnormal Fig. 2 with image from Wang et al., 2008

Phenotype of all Fish created by or utilizing MO3-myf6
Phenotype Fish Conditions Figures
axonogenesis disrupted, abnormal WT + MO2-myf6 + MO3-myf6 standard conditions Fig. 6 with image from Wang et al., 2008
primary motor neuron axon morphology, abnormal WT + MO2-myf6 + MO3-myf6 standard conditions Fig. 5 with image from Wang et al., 2008
somite border amorphous, abnormal WT + MO2-myf6 + MO3-myf6 standard conditions Fig. 2 with imageFig. 3 with image from Wang et al., 2008
somite U-shaped, abnormal WT + MO2-myf6 + MO3-myf6 standard conditions Fig. 3 with imageFig. 4 with image from Wang et al., 2008
somite myofibril misaligned with somite myofibril, abnormal WT + MO2-myf6 + MO3-myf6 standard conditions Fig. 3 with imageFig. 4 with image from Wang et al., 2008
trunk curved ventral, abnormal WT + MO2-myf6 + MO3-myf6 standard conditions Fig. 2 with image from Wang et al., 2008
trunk curved ventral, abnormal WT + MO3-myf6 standard conditions Fig. 2 with image from Wang et al., 2008
axonogenesis disrupted, abnormal WT + MO3-myf6 standard conditions Fig. 6 with image from Wang et al., 2008
somite myofibril misaligned with somite myofibril, abnormal WT + MO3-myf6 standard conditions Fig. 3 with imageFig. 4 with image from Wang et al., 2008
somite U-shaped, abnormal WT + MO3-myf6 standard conditions Fig. 4 with image from Wang et al., 2008
OTHER MO3-myf6 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)