Morpholino

MO2-lmo2

ID

ZDB-MRPHLNO-080625-2

Name

MO2-lmo2

Previous Names

Target

Sequence

5' - GTAGAAGCCATTTTCAATATGATTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lmo2

Expressed Gene	Anatomy	Figures
kdr	whole organism	Fig. S4 from Matrone et al., 2017

Phenotype

Phenotype resulting from MO2-lmo2

Phenotype	Fish	Figures
blood vessel endothelial cell accumulation intersegmental vessel, abnormal	y1Tg + MO2-lmo2	Fig. 3 from Matrone et al., 2017
endothelial cell proliferation disrupted, abnormal	y1Tg + MO2-lmo2	Fig. 6 from Meng et al., 2016
intersegmental vessel morphology, abnormal	y1Tg + MO2-lmo2	Fig. 1, Fig. 3, Fig. S1 from Matrone et al., 2017
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal	y1Tg + MO2-lmo2	Fig. 3 from Matrone et al., 2017
whole organism kdr expression decreased amount, abnormal	WIK + MO2-lmo2	Fig. S4 from Matrone et al., 2017

Phenotype of all Fish created by or utilizing MO2-lmo2

Phenotype	Fish	Conditions	Figures
whole organism kdr expression decreased amount, abnormal	WIK + MO2-lmo2	standard conditions	Fig. S4 from Matrone et al., 2017
regenerating fin vasculature decreased length, abnormal	y1Tg + MO2-lmo2	resection: caudal fin	Fig. 7 from Meng et al., 2016
intersegmental vessel morphology, abnormal	y1Tg + MO2-lmo2	standard conditions	Fig. 1, Fig. 3, Fig. S1 from Matrone et al., 2017
endothelial cell proliferation disrupted, abnormal	y1Tg + MO2-lmo2	standard conditions	Fig. 6 from Meng et al., 2016
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal	y1Tg + MO2-lmo2	standard conditions	Fig. 3 from Matrone et al., 2017
regenerating fin decreased size, abnormal	y1Tg + MO2-lmo2	resection: caudal fin	Fig. 7 from Meng et al., 2016
blood vessel endothelial cell accumulation intersegmental vessel, abnormal	y1Tg + MO2-lmo2	standard conditions	Fig. 3 from Matrone et al., 2017
fin regeneration decreased efficacy, abnormal	y1Tg + MO2-lmo2	resection: caudal fin	Fig. 7 from Meng et al., 2016
nucleate erythrocyte decreased amount, abnormal	sd2Tg; y1Tg + MO1-lmo2 + MO2-lmo2	standard conditions	Fig. S4 from Lalwani et al., 2012
trunk intersegmental vessel morphology, abnormal	sd2Tg; y1Tg + MO1-lmo2 + MO2-lmo2	standard conditions	Fig. S4 from Lalwani et al., 2012
blood vessel morphology, abnormal	sd2Tg; y1Tg + MO1-lmo2 + MO2-lmo2	standard conditions	Fig. S4 from Lalwani et al., 2012

Citations