header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080625-2
Morpholino Name: MO2-lmo2
Target: lmo2 (1)
Previous Name: lmo2 atgMO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTAGAAGCCATTTTCAATATGATTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lmo2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lmo2
Expressed Gene Anatomy Figures
kdr Fig. S4 from Matrone et al., 2017
PHENOTYPE
Phenotype resulting from MO2-lmo2
Phenotype of all Fish created by or utilizing MO2-lmo2
Genome Resources:
CITATIONS (4)