header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080501-1
Morpholino Name: MO1-tgif1
Target: tgif1 (1)
Sequence:
5' - ACACCCTTTTTGGTCTTCATGTCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tgif1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tgif1
Expressed Gene Anatomy Figures
aldh1a2 Fig. 1 from Gongal et al., 2008
arxa Fig. 4 from Gongal et al., 2008
barhl2 Fig. 4 from Gongal et al., 2008
ctslb text only from Gongal et al., 2008
cyp26a1 Fig. 1 from Gongal et al., 2008
egr2b Fig. 3 from Gongal et al., 2008
emx3 Fig. 4 from Gongal et al., 2008
hnf1ba Fig. 2Fig. 3 from Gongal et al., 2008
hoxd4a Fig. 3 from Gongal et al., 2008
meis3 Fig. 2 from Gongal et al., 2008
myod1 Fig. 2Fig. 3 from Gongal et al., 2008
nkx2.1 Fig. 4 from Gongal et al., 2008
nkx2.4b Fig. 4 from Gongal et al., 2008
otx2b Fig. 5 from Gongal et al., 2008
pax6a Fig. 4 from Gongal et al., 2008
ptch2 Fig. 4 from Gongal et al., 2008
rx1 text only from Gongal et al., 2008
rx2 text only from Gongal et al., 2008
shha Fig. 4 from Gongal et al., 2008
six3b text only from Gongal et al., 2008
tbxta Fig. 2Fig. 5 from Gongal et al., 2008
tlc Fig. 4 from Gongal et al., 2008
PHENOTYPE
Phenotype resulting from MO1-tgif1
No data available

Phenotype of all Fish created by or utilizing MO1-tgif1
No data available
Genome Resources:
CITATIONS (1)