ZFIN ID: ZDB-MRPHLNO-080414-1
Morpholino Name: MO5-otpb
Target: otpb (1)
Sequence:
5' - TGCAGCATCCTTCATCCCTGTGGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: otpb/sp2 Intron1-Exon2 splice-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-otpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-otpb
Expressed Gene Anatomy Figures
oxt Fig. 4 with image from Blechman et al., 2007
slc6a3 Fig. S3 with image from Blechman et al., 2007
th Fig. 4 with image from Blechman et al., 2007
PHENOTYPE
Phenotype resulting from MO5-otpb
Phenotype Figures
hypothalamus has fewer parts of type neurosecretory neuron, abnormal Fig. 4 with image from Blechman et al., 2007
hypothalamus has fewer parts of type dopaminergic neuron, abnormal Fig. S3 with image from Blechman et al., 2007

Phenotype of all Fish created by or utilizing MO5-otpb
Phenotype Fish Conditions Figures
hypothalamus has fewer parts of type neurosecretory neuron, abnormal WT + MO5-otpb standard conditions Fig. 4 with image from Blechman et al., 2007
hypothalamus has fewer parts of type dopaminergic neuron, abnormal WT + MO5-otpb standard conditions Fig. S3 with image from Blechman et al., 2007
OTHER MO5-otpb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)