header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080325-7
Morpholino Name: MO1-vsx2
Target: vsx2 (1)
Sequence:
5' - AAACAGCCCCATCCTTTCCTGTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-vsx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-vsx2
Expressed Gene Anatomy Figures
ccnd1 Fig. 7 from Clark et al., 2008
pax6a Fig. 7 from Clark et al., 2008
vsx1 Fig. 7 from Clark et al., 2008
PHENOTYPE
Phenotype resulting from MO1-vsx2
Phenotype of all Fish created by or utilizing MO1-vsx2
OTHER MO1-vsx2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)