header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080325-2
Morpholino Name: MO1-epor
Target: epor (1)
Sequence:
5' - AACTGGGCCACTGAACAATCAAATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino could not be confirmed to hit epor on Zv7. It does hit in the region suggesting an assembly error.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-epor No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-epor No data available
PHENOTYPE
Phenotype resulting from MO1-epor
No data available

Phenotype of all Fish created by or utilizing MO1-epor
Phenotype Fish Conditions Figures
nucleate erythrocyte decreased amount, abnormal WT + MO1-epor + MO2-epor standard conditions Fig. 4 from Paffett-Lugassy et al., 2007
definitive hemopoiesis arrested, abnormal WT + MO1-epor + MO2-epor standard conditions Fig. 4 from Paffett-Lugassy et al., 2007
primitive hemopoiesis disrupted, abnormal WT + MO1-epor + MO2-epor standard conditions Fig. 4 from Paffett-Lugassy et al., 2007
pronephric glomerulus size, ameliorated li1Tg + MO1-epor chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from She et al., 2017
pronephric glomerulus apoptotic process increased occurrence, abnormal li1Tg + MO1-epor control Fig. 5 with image from She et al., 2017
nucleate erythrocyte decreased amount, abnormal li1Tg + MO1-epor control Fig. 3 with image from She et al., 2017
pronephros functionality, ameliorated li1Tg + MO1-epor chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from She et al., 2017
pronephros decreased functionality, abnormal li1Tg + MO1-epor control Fig. 3 with image from She et al., 2017
pronephric podocyte podocyte foot immature, abnormal li1Tg + MO1-epor control Fig. S4 with image from She et al., 2017
pronephros apoptotic process increased occurrence, abnormal li1Tg + MO1-epor control Fig. 5 with image from She et al., 2017
pronephric tubule decreased length, abnormal li1Tg + MO1-epor control Fig. 3 with imageFig. 6 with image from She et al., 2017
pronephric podocyte glomerular visceral epithelial cell development decreased process quality, abnormal li1Tg + MO1-epor control Fig. S4 with image from She et al., 2017
pronephric glomerulus increased size, abnormal li1Tg + MO1-epor control Fig. 3 with imageFig. 6 with image from She et al., 2017
pronephric tubule length, ameliorated li1Tg + MO1-epor chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 6 with image from She et al., 2017
pronephros lacks all parts of type pronephric capsular space, abnormal li1Tg + MO1-epor control Fig. S4 with image from She et al., 2017
OTHER MO1-epor MORPHOLINO PAGES No links to external sites
CITATIONS (3)