Morpholino

MO1-epor

ID

ZDB-MRPHLNO-080325-2

Name

MO1-epor

Previous Names

None

Target

epor (1)

Sequence

5' - AACTGGGCCACTGAACAATCAAATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino could not be confirmed to hit epor on Zv7. It does hit in the region suggesting an assembly error.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-epor

Expressed Gene	Anatomy	Figures
nphs2	whole organism	Fig. 3 from She et al., 2017

Phenotype

Phenotype resulting from MO1-epor

Phenotype	Fish	Figures
nucleate erythrocyte decreased amount, abnormal	li1Tg + MO1-epor	Fig. 3 from She et al., 2017
pronephric glomerulus increased size, abnormal	li1Tg + MO1-epor	Fig. 3 , Fig. 6 from She et al., 2017
pronephric glomerulus apoptotic process increased occurrence, abnormal	li1Tg + MO1-epor	Fig. 5 from She et al., 2017
pronephric podocyte podocyte development decreased process quality, abnormal	li1Tg + MO1-epor	Fig. S4 from She et al., 2017
pronephric podocyte podocyte foot immature, abnormal	li1Tg + MO1-epor	Fig. S4 from She et al., 2017
pronephric tubule decreased length, abnormal	li1Tg + MO1-epor	Fig. 3 , Fig. 6 from She et al., 2017
pronephros decreased functionality, abnormal	li1Tg + MO1-epor	Fig. 3 from She et al., 2017
pronephros lacks all parts of type pronephric capsular space, abnormal	li1Tg + MO1-epor	Fig. S4 from She et al., 2017
pronephros apoptotic process increased occurrence, abnormal	li1Tg + MO1-epor	Fig. 5 from She et al., 2017

Phenotype of all Fish created by or utilizing MO1-epor

Phenotype	Fish	Conditions	Figures
nucleate erythrocyte decreased amount, abnormal	WT + MO1-epor + MO2-epor	standard conditions	Fig. 4 from Paffett-Lugassy et al., 2007
definitive hemopoiesis arrested, abnormal	WT + MO1-epor + MO2-epor	standard conditions	Fig. 4 from Paffett-Lugassy et al., 2007
primitive hemopoiesis disrupted, abnormal	WT + MO1-epor + MO2-epor	standard conditions	Fig. 4 from Paffett-Lugassy et al., 2007
pronephric glomerulus size, ameliorated	li1Tg + MO1-epor	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 6 from She et al., 2017
pronephros lacks all parts of type pronephric capsular space, abnormal	li1Tg + MO1-epor	control	Fig. S4 from She et al., 2017
pronephros apoptotic process increased occurrence, abnormal	li1Tg + MO1-epor	control	Fig. 5 from She et al., 2017
pronephros decreased functionality, abnormal	li1Tg + MO1-epor	control	Fig. 3 from She et al., 2017
pronephros functionality, ameliorated	li1Tg + MO1-epor	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 6 from She et al., 2017
pronephric tubule decreased length, abnormal	li1Tg + MO1-epor	control	Fig. 3 , Fig. 6 from She et al., 2017
pronephric glomerulus apoptotic process increased occurrence, abnormal	li1Tg + MO1-epor	control	Fig. 5 from She et al., 2017
pronephric tubule length, ameliorated	li1Tg + MO1-epor	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 6 from She et al., 2017
pronephric podocyte podocyte foot immature, abnormal	li1Tg + MO1-epor	control	Fig. S4 from She et al., 2017
pronephric podocyte podocyte development decreased process quality, abnormal	li1Tg + MO1-epor	control	Fig. S4 from She et al., 2017
nucleate erythrocyte decreased amount, abnormal	li1Tg + MO1-epor	control	Fig. 3 from She et al., 2017
pronephric glomerulus increased size, abnormal	li1Tg + MO1-epor	control	Fig. 3 , Fig. 6 from She et al., 2017

Citations