ZFIN ID: ZDB-MRPHLNO-080320-1
Morpholino Name: MO1-bmp15
Target: bmp15 (1)
Sequence:
5' - CCGCTGGTAGCCTTCATGTTCAGCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-bmp15 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-bmp15
Expressed Gene Anatomy Figures
bmp15 Fig. 1 from Tan et al., 2009
Fig. 7 from Clelland et al., 2007
paqr7b Fig. 2 with image from Tan et al., 2009
paqr8 Fig. 2 with image from Tan et al., 2009
PHENOTYPE
Phenotype resulting from MO1-bmp15
Phenotype Figures
oocyte maturity, abnormal Fig. 1 from Tan et al., 2009
oocyte maturation increased occurrence, abnormal Fig. 1Fig. 3 from Tan et al., 2009
ovarian follicle maturity, abnormal Fig. 7 from Clelland et al., 2007
ovarian follicle development premature, abnormal Fig. 7 from Clelland et al., 2007

Phenotype of all Fish created by or utilizing MO1-bmp15
Phenotype Fish Conditions Figures
oocyte maturity, abnormal WT + MO1-bmp15 chemical treatment: Activin A Fig. 1 from Tan et al., 2009
oocyte maturation increased occurrence, abnormal WT + MO1-bmp15 standard conditions Fig. 1Fig. 3 from Tan et al., 2009
ovarian follicle maturity, abnormal WT + MO1-bmp15 standard conditions Fig. 7 from Clelland et al., 2007
oocyte maturity, abnormal WT + MO1-bmp15 standard conditions Fig. 1 from Tan et al., 2009
ovarian follicle development premature, abnormal WT + MO1-bmp15 standard conditions Fig. 7 from Clelland et al., 2007
oocyte maturation increased occurrence, abnormal WT + MO1-bmp15 chemical treatment: Activin A Fig. 1 from Tan et al., 2009
OTHER MO1-bmp15 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)