ZFIN ID: ZDB-MRPHLNO-080319-2
Morpholino Name: MO1-itgb1b
Target: itgb1b (1)
Sequence:
5' - AATCAGGAGCAGCCTTACGTCCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-itgb1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-itgb1b No data available
PHENOTYPE
Phenotype resulting from MO1-itgb1b
Phenotype Figures
brain hemorrhagic, abnormal Fig. 8 from Wu et al., 2015
cardiac muscle Z disc EGFP expression spatial pattern, abnormal Fig. 5 from Wu et al., 2015
cardiac muscle cell Z disc decreased amount, abnormal Fig. 8 from Wu et al., 2015
cardiac muscle cell Z disc disorganized, abnormal Fig. 5 from Wu et al., 2015
cardiac ventricle decreased volume, abnormal Fig. 8 from Wu et al., 2015
dorsal aorta decreased diameter, abnormal Fig. 8 from Wu et al., 2015
intersegmental vessel GFP expression decreased amount, abnormal Fig. 8 from Wu et al., 2015
posterior cardinal vein decreased diameter, abnormal Fig. 8 from Wu et al., 2015
ventricular myocardium striated muscle thin filament ab1-tpm labeling decreased amount, abnormal Fig. 8 from Wu et al., 2015
ventricular myocardium Z disc ab1-actn labeling decreased amount, abnormal Fig. 8 from Wu et al., 2015

Phenotype of all Fish created by or utilizing MO1-itgb1b
Phenotype Fish Conditions Figures
ventricular myocardium striated muscle thin filament ab1-tpm labeling decreased amount, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
cardiac muscle cell Z disc decreased amount, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
cardiac ventricle decreased volume, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-itgb1b standard conditions Fig. 5 from Wu et al., 2015
ventricular myocardium Z disc ab1-actn labeling decreased amount, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
brain hemorrhagic, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
dorsal aorta decreased diameter, abnormal la116Tg + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
posterior cardinal vein decreased diameter, abnormal la116Tg + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
intersegmental vessel GFP expression decreased amount, abnormal la116Tg + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
cardiac muscle Z disc EGFP expression spatial pattern, abnormal pku316Tg + MO1-itgb1b(TL) standard conditions Fig. 5 from Wu et al., 2015
ventricular myocardium Z disc ab1-actn labeling decreased amount, abnormal WT + MO1-itgb1b + MO1-tln1 standard conditions Fig. 8 from Wu et al., 2015
OTHER MO1-itgb1b MORPHOLINO PAGESNo links to external sites
CITATIONS (3)