header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080225-2
Morpholino Name: MO2-fbxo32
Target: fbxo32 (1)
Sequence:
5' - AAAGCCACCATCATGTACCTGTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-fbxo32 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-fbxo32
Expressed Gene Anatomy Figures
fbxo32 Fig. 7 from Hanai et al., 2007
PHENOTYPE
Phenotype resulting from MO2-fbxo32
No data available

Phenotype of all Fish created by or utilizing MO2-fbxo32
OTHER MO2-fbxo32 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)