header logo image header logo text
Downloads Login
General Information
Morpholino Name: MO1-fbxo32
Target: fbxo32 (1)
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The published morpholino sequence is missing a nucleotide when compared to BC052112 (target sequence CTTGACAATGCCGTTTCTTGGACAA).
No data available
Gene expression in Wild Types + MO1-fbxo32 No data available
Phenotype resulting from MO1-fbxo32
No data available

Phenotype of all Fish created by or utilizing MO1-fbxo32
No data available
OTHER MO1-fbxo32 MORPHOLINO PAGESNo links to external sites