ZFIN ID: ZDB-MRPHLNO-080202-2
Morpholino Name: MO2-hmgcra
Target: hmgcra (1)
Sequence:
5' - GTGATGACCTGCTCAATGTCCATGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-hmgcra No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-hmgcra No data available
PHENOTYPE
Phenotype resulting from MO2-hmgcra
No data available

Phenotype of all Fish created by or utilizing MO2-hmgcra
Phenotype Fish Conditions Figures
somite border morphology, abnormal WT + MO1-hmgcra + MO2-hmgcra standard conditions Fig. 6 from Hanai et al., 2007
muscle morphology, abnormal WT + MO1-hmgcra + MO2-hmgcra standard conditions Fig. 6 from Hanai et al., 2007
skeletal muscle tissue development disrupted, abnormal WT + MO1-hmgcra + MO2-hmgcra standard conditions Fig. 6 from Hanai et al., 2007
myotome skeletal muscle cell morphology, abnormal WT + MO1-hmgcra + MO2-hmgcra standard conditions Fig. 6 from Hanai et al., 2007
skeletal muscle tissue development disrupted, abnormal WT + MO2-fbxo32 + MO2-hmgcra standard conditions Fig. 6 from Hanai et al., 2007
muscle morphology, abnormal WT + MO2-fbxo32 + MO2-hmgcra standard conditions Fig. 6 from Hanai et al., 2007
myotome skeletal muscle cell morphology, abnormal WT + MO2-fbxo32 + MO2-hmgcra standard conditions Fig. 6 from Hanai et al., 2007
OTHER MO2-hmgcra MORPHOLINO PAGESNo links to external sites
CITATIONS (1)