ZFIN ID: ZDB-MRPHLNO-080110-3
Morpholino Name: MO3-foxh1
Target: foxh1 (1)
Sequence:
5' - TACTTAACCCTACCTCTGATAAAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino which targets the exon 1 splice donor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-foxh1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-foxh1 No data available
PHENOTYPE
Phenotype resulting from MO3-foxh1
No data available

Phenotype of all Fish created by or utilizing MO3-foxh1
No data available
OTHER MO3-foxh1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)