header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080109-6
Morpholino Name: MO3-lft2
Target: lft2 (1)
Previous Name: lft2-TPmiR-430 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAAATACTTTGTTTTTCAAGTGCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Target protector morpholino. Blocks the binding of mirn430c miRNA in 3'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-lft2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-lft2
Expressed Gene Anatomy Figures
gsc Fig. 4Fig. S6 from Choi et al., 2007
lft2 Fig. 3 from Choi et al., 2007
sox17 Fig. 4 from Choi et al., 2007
PHENOTYPE
Phenotype resulting from MO3-lft2
Phenotype of all Fish created by or utilizing MO3-lft2
OTHER MO3-lft2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)