ZFIN ID: ZDB-MRPHLNO-071228-3
Morpholino Name: MO2-six3b
Target: six3b (1)
Previous Name: six3 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTCTAAAGGAGACCTGAAAACCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-six3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-six3b
Expressed Gene Anatomy Figures
arxa Fig. 4 with image from Sanek et al., 2009
dlx2a Fig. 4 with image from Sanek et al., 2009
emx1 Fig. 8 with image from McCollum et al., 2007
pax6b Fig. 8 with image from McCollum et al., 2007
PHENOTYPE
Phenotype resulting from MO2-six3b
No data available

Phenotype of all Fish created by or utilizing MO2-six3b
No data available
OTHER MO2-six3b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)