ZFIN ID: ZDB-MRPHLNO-071221-7
Morpholino Name: MO1-rbfox1
Target: rbfox1 (1)
Previous Name: MO1-a2bp1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTGCTCCCTTTTTCCTCCATAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rbfox1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rbfox1 No data available
PHENOTYPE
Phenotype resulting from MO1-rbfox1
No data available

Phenotype of all Fish created by or utilizing MO1-rbfox1
Phenotype Fish Conditions Figures
hypothalamus development disrupted, abnormal WT + MO1-rbfox1 + MO2-rbfox1 standard conditions Fig. 4text only from Kurrasch et al., 2007
OTHER MO1-rbfox1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)