Morpholino

MO1-gsk3ba

ID
ZDB-MRPHLNO-071220-2
Name
MO1-gsk3ba
Previous Names
  • MO1-gsk3b
Target
Sequence
5' - GTTCTGGGCCGACCGGACATTTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gsk3ba
Expressed Gene Anatomy Figures
bmp4 Fig. 6 with image,  Fig. 7 with image from Lee et al., 2007
cdh5 Fig. 2 from Lee et al., 2014
dlc Fig. 2 from Lee et al., 2014
dlx2a Fig. S3 with image from Lee et al., 2007
ephb4a Fig. 2 from Lee et al., 2014
fli1 Fig. 2,  Fig. 4 from Lee et al., 2014
flt4 Fig. 2 from Lee et al., 2014
kdr Fig. 2,  Fig. 4 from Lee et al., 2014
lft1 Fig. 6 with image from Lee et al., 2007
myh6 Fig. 5 with image from Lee et al., 2007
myh7 Fig. 5 with image from Lee et al., 2007
myl7 Fig. 4 with image,  Fig. 5 with image from Lee et al., 2007
notch3 Fig. 2 from Lee et al., 2014
shha Fig. S3 with image from Lee et al., 2007
vcana Fig. 7 with image from Lee et al., 2007
vegfaa Fig. 3 from Lee et al., 2014
Phenotype
Phenotype resulting from MO1-gsk3ba
Phenotype Fish Figures
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-gsk3ba Fig. 1 from Lee et al., 2014
heart linear, abnormal AB + MO1-gsk3ba Fig. 2 with image,  Fig. 3 with image,  Fig. S2 with image from Lee et al., 2007
heart looping disrupted, abnormal AB + MO1-gsk3ba Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. S2 with image from Lee et al., 2007
heart morphogenesis disrupted, abnormal AB + MO1-gsk3ba Fig. 2 with image,  Fig. 3 with image from Lee et al., 2007
heart valve aplastic, abnormal zf10Tg + MO1-gsk3ba Fig. 7 with image from Lee et al., 2007
intersegmental vessel malformed, abnormal y1Tg + MO1-gsk3ba Fig. 1,  Fig. 4 from Lee et al., 2014
pectoral fin decreased size, abnormal AB + MO1-gsk3ba Fig. S3 with image from Lee et al., 2007
pericardium edematous, abnormal AB + MO1-gsk3ba Fig. 2 with image from Lee et al., 2007
phosphatidylinositol 3-kinase/protein kinase B signal transduction decreased process quality, abnormal WT + MO1-gsk3ba Fig. 5 from Lee et al., 2014
trunk vasculature angiogenesis process quality, abnormal y1Tg + MO1-gsk3ba Fig. 1,  Fig. 4 from Lee et al., 2014
Wnt signaling pathway decreased process quality, abnormal WT + MO1-gsk3ba Fig. 6 from Lee et al., 2014
Phenotype of all Fish created by or utilizing MO1-gsk3ba
Phenotype Fish Conditions Figures
heart looping disrupted, abnormal AB + MO1-gsk3ba standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. S2 with image from Lee et al., 2007
heart morphogenesis disrupted, abnormal AB + MO1-gsk3ba standard conditions Fig. 2 with image from Lee et al., 2007
pectoral fin decreased size, abnormal AB + MO1-gsk3ba standard conditions Fig. S3 with image from Lee et al., 2007
pericardium edematous, abnormal AB + MO1-gsk3ba standard conditions Fig. 2 with image from Lee et al., 2007
heart linear, abnormal AB + MO1-gsk3ba standard conditions Fig. 2 with image,  Fig. S2 with image from Lee et al., 2007
phosphatidylinositol 3-kinase/protein kinase B signal transduction decreased process quality, abnormal WT + MO1-gsk3ba standard conditions Fig. 5 from Lee et al., 2014
Wnt signaling pathway decreased process quality, abnormal WT + MO1-gsk3ba standard conditions Fig. 6 from Lee et al., 2014
heart linear, abnormal twu34Tg + MO1-gsk3ba standard conditions Fig. 3 with image from Lee et al., 2007
heart looping disrupted, abnormal twu34Tg + MO1-gsk3ba standard conditions Fig. 3 with image from Lee et al., 2007
heart morphogenesis disrupted, abnormal twu34Tg + MO1-gsk3ba standard conditions Fig. 3 with image from Lee et al., 2007
trunk vasculature angiogenesis process quality, abnormal y1Tg + MO1-gsk3ba standard conditions Fig. 1,  Fig. 4 from Lee et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO1-gsk3ba standard conditions Fig. 1,  Fig. 4 from Lee et al., 2014
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-gsk3ba standard conditions Fig. 1 from Lee et al., 2014
heart valve aplastic, abnormal zf10Tg + MO1-gsk3ba standard conditions Fig. 7 with image from Lee et al., 2007
whole organism dorsalized, abnormal AB + MO1-gsk3ab + MO1-gsk3ba standard conditions Fig. S9 from Lin et al., 2015
whole organism dorsalized, exacerbated AB + MO1-cdk5rap3 + MO1-gsk3ab + MO1-gsk3ba standard conditions Fig. S9 from Lin et al., 2015
Wnt signaling pathway decreased process quality, abnormal w34Tg + MO1-gsk3ba heat shock Fig. 6 from Lee et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.