Morpholino

MO1-rtf1

ID

ZDB-MRPHLNO-071219-3

Name

MO1-rtf1

Previous Names

None

Target

rtf1 (1)

Sequence

5' - CTTTCCGTTTCTTTACATTCACCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rtf1

Expressed Gene	Anatomy	Figures
crestin	(not) neural crest	Fig. S5 from Akanuma et al., 2007
gata4	anterior lateral plate mesoderm	Fig. 5 from Langenbacher et al., 2011
gata5	anterior lateral plate mesoderm	Fig. 5 from Langenbacher et al., 2011
hand2	anterior lateral plate mesoderm	Fig. 5 from Langenbacher et al., 2011
her1	segmental plate	Fig. S4 from Akanuma et al., 2007
myl7	(not) whole organism	Fig. 3 from Langenbacher et al., 2011
nkx2.5	cardiac muscle myoblast	Fig. 3 from Langenbacher et al., 2011
rtf1	whole organism	Fig. s3 from Langenbacher et al., 2011
tbx20	anterior lateral plate mesoderm cardiac muscle myoblast	Fig. 5 from Langenbacher et al., 2011

Phenotype

Phenotype resulting from MO1-rtf1

Phenotype	Fish	Figures
cardiac cell fate specification process quality, abnormal	WT + MO1-rtf1	Fig. 5 from Langenbacher et al., 2011
cardiac muscle cell absent, abnormal	WT + MO1-rtf1	Fig. 3 from Langenbacher et al., 2011
cardiac muscle progenitor cell migration to the midline involved in heart field formation arrested, abnormal	WT + MO1-rtf1	Fig. 3 from Langenbacher et al., 2011
embryonic heart tube morphogenesis arrested, abnormal	WT + MO1-rtf1	Fig. 3 from Langenbacher et al., 2011
myocardial precursor decreased amount, abnormal	WT + MO1-rtf1	Fig. 3 from Langenbacher et al., 2011
neural crest cell decreased amount, abnormal	WT + MO1-rtf1	Fig. S5 from Akanuma et al., 2007
neural crest cell development disrupted, abnormal	WT + MO1-rtf1	Fig. S5 from Akanuma et al., 2007

Phenotype of all Fish created by or utilizing MO1-rtf1

Phenotype	Fish	Conditions	Figures
embryonic heart tube morphogenesis arrested, abnormal	WT + MO1-rtf1	standard conditions	Fig. 3 from Langenbacher et al., 2011
cardiac muscle progenitor cell migration to the midline involved in heart field formation arrested, abnormal	WT + MO1-rtf1	standard conditions	Fig. 3 from Langenbacher et al., 2011
neural crest cell development disrupted, abnormal	WT + MO1-rtf1	standard conditions	Fig. S5 from Akanuma et al., 2007
cardiac cell fate specification process quality, abnormal	WT + MO1-rtf1	standard conditions	Fig. 5 from Langenbacher et al., 2011
cardiac muscle cell absent, abnormal	WT + MO1-rtf1	standard conditions	Fig. 3 from Langenbacher et al., 2011
neural crest cell decreased amount, abnormal	WT + MO1-rtf1	standard conditions	Fig. S5 from Akanuma et al., 2007
myocardial precursor decreased amount, abnormal	WT + MO1-rtf1	standard conditions	Fig. 3 from Langenbacher et al., 2011
neural crest cell development disrupted, abnormal	Df(Chr15:supt5h)s30/s30 + MO1-rtf1	standard conditions	Fig. S5 from Akanuma et al., 2007
somitogenesis disrupted, abnormal	Df(Chr15:supt5h)s30/s30 + MO1-rtf1	standard conditions	Fig. S4 from Akanuma et al., 2007
tail bud decreased size, abnormal	Df(Chr15:supt5h)s30/s30 + MO1-rtf1	standard conditions	Fig. S4 from Akanuma et al., 2007
neural crest cell absent, abnormal	Df(Chr15:supt5h)s30/s30 + MO1-rtf1	standard conditions	Fig. S5 from Akanuma et al., 2007
post-anal tail morphogenesis disrupted, abnormal	Df(Chr15:supt5h)s30/s30 + MO1-rtf1	standard conditions	Fig. S4 from Akanuma et al., 2007
whole organism decreased length, abnormal	Df(Chr15:supt5h)s30/s30 + MO1-rtf1	standard conditions	Fig. S4 from Akanuma et al., 2007

Citations