header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-071130-1
Morpholino Name: MO3-tbxta
Target: tbxta (1)
Previous Names: MO3-ntl, MO3-ta

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GACTTGAGGCAGACATATTTCCGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Published as a photoactivatable morpholino. A photo-cleavable version of this MO was described in Tallafuss et al. 2012 (ZDB-PUB-120412-12). MO nucleotide 13 (A) was replaced by a photo-sensitive subunit.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-tbxta No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-tbxta
Expressed Gene Anatomy Figures
myh9a Fig. 4 with image from Veerkamp et al., 2013
PHENOTYPE
Phenotype resulting from MO3-tbxta
Phenotype of all Fish created by or utilizing MO3-tbxta
OTHER MO3-tbxta MORPHOLINO PAGESNo links to external sites
CITATIONS (14)