header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-071128-2
Morpholino Name: MO2-hsp90aa1.1
Target: hsp90aa1.1 (1)
Previous Names: hsp9a2-Mo (1), MO2-hsp90a.1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCGACTTCTCAGGCATCTTGCTGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Morpholino sequences for hsp90a.1 and hsp90a.2 genes are reversed in Etard et al.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-hsp90aa1.1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-hsp90aa1.1
Expressed Gene Anatomy Figures
hsp90aa1.1 Fig. S8 with image from Hawkins et al., 2008
hspa8l Fig. S8 with image from Hawkins et al., 2008
unc45b Fig. S8 with image from Hawkins et al., 2008
PHENOTYPE
Phenotype resulting from MO2-hsp90aa1.1
Phenotype of all Fish created by or utilizing MO2-hsp90aa1.1
Genome Resources:
CITATIONS (3)