ZFIN ID: ZDB-MRPHLNO-070906-15
Morpholino Name: MO2-amot
Target: amot (1)
Sequence:
5' - CCTTACTTGACCTATTGAGGAGCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-amot No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-amot No data available
PHENOTYPE
Phenotype resulting from MO2-amot
Phenotype Figures
angiogenesis disrupted, abnormal Fig. 5 from Garnaas et al., 2008
blood vessel endothelial cell migration disrupted, abnormal Fig. 1 from Aase et al., 2007
blood vessel morphogenesis disrupted, abnormal Fig. 5 from Garnaas et al., 2008
cell migration involved in sprouting angiogenesis arrested, abnormal Fig. 1 from Aase et al., 2007
dorsal longitudinal anastomotic vessel aplastic, abnormal Fig. 1 from Aase et al., 2007
endothelial tip cell filopodium decreased amount, abnormal Fig. 1 from Aase et al., 2007
intersegmental vessel truncated, abnormal Fig. 5 from Garnaas et al., 2008
Fig. 1text only from Aase et al., 2007
primordial hindbrain channel dilated, abnormal Fig. 1 from Aase et al., 2007
primordial midbrain channel dilated, abnormal Fig. 1 from Aase et al., 2007

Phenotype of all Fish created by or utilizing MO2-amot
Phenotype Fish Conditions Figures
primordial hindbrain channel dilated, abnormal y1Tg + MO2-amot standard conditions Fig. 1 from Aase et al., 2007
endothelial tip cell filopodium decreased amount, abnormal y1Tg + MO2-amot standard conditions Fig. 1 from Aase et al., 2007
primordial midbrain channel dilated, abnormal y1Tg + MO2-amot standard conditions Fig. 1 from Aase et al., 2007
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO2-amot standard conditions Fig. 1 from Aase et al., 2007
intersegmental vessel truncated, abnormal y1Tg + MO2-amot standard conditions Fig. 1text only from Aase et al., 2007
cell migration involved in sprouting angiogenesis arrested, abnormal y1Tg + MO2-amot standard conditions Fig. 1 from Aase et al., 2007
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO2-amot standard conditions Fig. 1 from Aase et al., 2007
angiogenesis disrupted, abnormal zf528Tg + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal zf528Tg + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
intersegmental vessel truncated, abnormal zf528Tg + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
endothelial tip cell circular, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
intersegmental vessel truncated, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
endothelial tip cell filopodium absent, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
angiogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
OTHER MO2-amot MORPHOLINO PAGESNo links to external sites
CITATIONS (2)