header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070801-1
Morpholino Name: MO8-tal1
Target: tal1 (1)
Sequence:
5' - GCGGACTCAACTGCACCATTCGAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO8-tal1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO8-tal1
Expressed Gene Anatomy Figures
dlc Fig. S2 with image from Qian et al., 2007
gata1a Fig. 3 with image from Qian et al., 2007
hbbe1.1 Fig. 3 with image from Qian et al., 2007
hey2 Fig. S2 with image from Qian et al., 2007
myb Fig. 6 with image from Qian et al., 2007
rag1 Fig. 6 with image from Qian et al., 2007
runx1 Fig. 6 with image from Qian et al., 2007
spi1b Fig. 3 with image from Qian et al., 2007
tal1 Fig. 3 with image from Qian et al., 2007
PHENOTYPE
Phenotype resulting from MO8-tal1
Phenotype of all Fish created by or utilizing MO8-tal1
OTHER MO8-tal1 MORPHOLINO PAGES No links to external sites
CITATIONS (2)