ZFIN ID: ZDB-MRPHLNO-070615-2
Morpholino Name: MO8-jag2b
Target: jag2b (1)
Previous Names: jagged2-MO (1), MO8-jag2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGAGCTCTCACCTTCGTCCACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO8-jag2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO8-jag2b
Expressed Gene Anatomy Figures
alcama Fig. 1 from Yeo et al., 2007
gad1b Fig. 1 from Yeo et al., 2007
her4.1 Fig. 8 from Yeo et al., 2007
isl1 Fig. 1 from Yeo et al., 2007
isl2a Fig. 1 from Yeo et al., 2007
nkx2.2b Fig. 8 from Yeo et al., 2007
PHENOTYPE
Phenotype resulting from MO8-jag2b
Phenotype Figures
spinal cord GABAergic neuron increased amount, abnormal Fig. 1Fig. 4 from Yeo et al., 2007
spinal cord GABAergic neuron mislocalised, abnormal Fig. 4 from Yeo et al., 2007
spinal cord motor neuron increased amount, abnormal Fig. 1 from Yeo et al., 2007
spinal cord motor neuron mislocalised, abnormal Fig. 1 from Yeo et al., 2007

Phenotype of all Fish created by or utilizing MO8-jag2b
Phenotype Fish Conditions Figures
spinal cord GABAergic neuron increased amount, abnormal AB + MO8-jag2b standard conditions Fig. 1Fig. 4 from Yeo et al., 2007
spinal cord motor neuron increased amount, abnormal AB + MO8-jag2b standard conditions Fig. 1 from Yeo et al., 2007
spinal cord GABAergic neuron mislocalised, abnormal AB + MO8-jag2b standard conditions Fig. 4 from Yeo et al., 2007
spinal cord motor neuron mislocalised, abnormal AB + MO8-jag2b standard conditions Fig. 1 from Yeo et al., 2007
OTHER MO8-jag2b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)