header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070614-1
Morpholino Name: MO5-jag2b
Target: jag2b (1)
Previous Name: MO5-jag2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATGCCGCCGATTTGATGTGTTATA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation blocker (-22 to +3)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-jag2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-jag2b
Expressed Gene Anatomy Figures
atp1b1a Fig. 4 with image from Ma et al., 2007
cetn4 Fig. 4 with image from Ma et al., 2007
foxj1a Fig. 3 with image from Zhou et al., 2015
foxj1b Fig. 3 with image from Zhou et al., 2015
gmnc Fig. 3 with image from Zhou et al., 2015
mcidasl Fig. 3 with image from Zhou et al., 2015
rfx2 Fig. 4 with image from Ma et al., 2007
PHENOTYPE
Phenotype resulting from MO5-jag2b
Phenotype of all Fish created by or utilizing MO5-jag2b
OTHER MO5-jag2b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)