ZFIN ID: ZDB-MRPHLNO-070612-5
Morpholino Name: MO8-neurog1
Target: neurog1 (1)
Previous Name: ngn1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGATCTCCATTGTTGATAACCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO8-neurog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO8-neurog1 No data available
PHENOTYPE
Phenotype resulting from MO8-neurog1
No data available

Phenotype of all Fish created by or utilizing MO8-neurog1
No data available
OTHER MO8-neurog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)