header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070611-2
Morpholino Name: MO4-jag2b
Target: jag2b (1)
Previous Names: J2ex20MO (1), j2exon 20 (1), MO4-jag2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTTTGAGATACTCACTGATACGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker, targeted to exon 20
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-jag2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-jag2b
Expressed Gene Anatomy Figures
flr Fig. 5 with image from Liu et al., 2007
her9 Fig. S2 with image from Liu et al., 2007
odf3b Fig. 5 with image from Liu et al., 2007
rfx2 Fig. 5 with image from Liu et al., 2007
slc13a1 Fig. 5 with image from Liu et al., 2007
trpm7 Fig. 5 with image from Liu et al., 2007
PHENOTYPE
Phenotype resulting from MO4-jag2b
Phenotype of all Fish created by or utilizing MO4-jag2b
OTHER MO4-jag2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)