ZFIN ID: ZDB-MRPHLNO-070611-2
Morpholino Name: MO4-jag2b
Target: jag2b (1)
Previous Names: J2ex20MO (1), j2exon 20 (1), MO4-jag2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTTTGAGATACTCACTGATACGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker, targeted to exon 20
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-jag2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-jag2b
Expressed Gene Anatomy Figures
flr Fig. 5 with image from Liu et al., 2007
her9 Fig. S2 with image from Liu et al., 2007
odf3b Fig. 5 with image from Liu et al., 2007
rfx2 Fig. 5 with image from Liu et al., 2007
slc13a1 Fig. 5 with image from Liu et al., 2007
trpm7 Fig. 5 with image from Liu et al., 2007
PHENOTYPE
Phenotype resulting from MO4-jag2b
Phenotype Figures
cell differentiation involved in pronephros development disrupted, abnormal Fig. 5 with image from Liu et al., 2007
cilium assembly increased occurrence, abnormal Fig. 10 with image from Liu et al., 2007
pronephros cilium increased amount, abnormal Fig. 10 with image from Liu et al., 2007
pronephros multi-ciliated epithelial cell increased amount, abnormal Fig. 5 with image from Liu et al., 2007

Phenotype of all Fish created by or utilizing MO4-jag2b
Phenotype Fish Conditions Figures
cilium assembly increased occurrence, abnormal WT + MO4-jag2b standard conditions Fig. 10 with image from Liu et al., 2007
pronephros cilium increased amount, abnormal WT + MO4-jag2b standard conditions Fig. 10 with image from Liu et al., 2007
pronephros multi-ciliated epithelial cell increased amount, abnormal WT + MO4-jag2b standard conditions Fig. 5 with image from Liu et al., 2007
cell differentiation involved in pronephros development disrupted, abnormal WT + MO4-jag2b standard conditions Fig. 5 with image from Liu et al., 2007
OTHER MO4-jag2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)