header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070604-3
Morpholino Name: MO2-tcf7l1a
Target: tcf7l1a (1)
Sequence:
5' - TTTTTGCTTACTTCGGAGTCTGATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tcf7l1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tcf7l1a
Expressed Gene Anatomy Figures
tcf7l1a Fig. 1 with image from Gribble et al., 2009
PHENOTYPE
Phenotype resulting from MO2-tcf7l1a
Phenotype of all Fish created by or utilizing MO2-tcf7l1a
Phenotype Fish Conditions Figures
forebrain decreased size, abnormal WT + MO2-tcf7l1a standard conditions text only from Gribble et al., 2009
forebrain truncated, abnormal WT + MO2-tcf7l1a standard conditions text only from Gribble et al., 2009
whole organism decreased length, abnormal WT + MO2-tcf7l1a standard conditions text only from Gribble et al., 2009
generation of neurons disrupted, abnormal AB + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 6 with image from Gribble et al., 2009
spinal cord neuroblast (sensu Vertebrata) cellular quality, abnormal AB + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 6 with image from Gribble et al., 2009
cell population proliferation occurrence, abnormal AB + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 4 with image from Bonner et al., 2008
midbrain increased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. S4 with image from Nyholm et al., 2007
forebrain wholly posterioralized, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
midbrain decreased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
spinal cord neuroblast (sensu Vertebrata) cellular quality, abnormal WT + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 4 with image from Gribble et al., 2009
brain decreased size, abnormal WT + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 1 with image from Gribble et al., 2009
whole organism decreased length, abnormal WT + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 1 with image from Gribble et al., 2009
cell population proliferation decreased rate, abnormal WT + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 4 with image from Gribble et al., 2009
eye aplastic, abnormal WT + MO2-tcf7l1a + MO3-tcf7l1b standard conditions Fig. 1 with image from Gribble et al., 2009
OTHER MO2-tcf7l1a MORPHOLINO PAGESNo links to external sites
CITATIONS (4)