ZFIN ID: ZDB-MRPHLNO-070531-5
Morpholino Name: MO3-otpb
Target: otpb (1)
Sequence:
5' - GAGCAAGTTCATTAAGTCTCACCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-site-specific MO targeted to the second exon–intron boundary of the otpb gene.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-otpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-otpb
Expressed Gene Anatomy Figures
fezf2 Fig. 1 with image from Wolf et al., 2013
foxb1a Fig. 1 with image from Wolf et al., 2013
otpa Fig. 2 from Ryu et al., 2007
sim1a Fig. 5 with image from Löhr et al., 2009
sim1b Fig. 5 with image from Löhr et al., 2009
th Fig. 4Fig. 6Fig. 7Fig. 8 from Kastenhuber et al., 2010
Fig. 2Fig. S6 from Ryu et al., 2007
uts1 Fig. 7 with image from Wolf et al., 2013
vip Fig. 7 with image from Wolf et al., 2013
PHENOTYPE
Phenotype resulting from MO3-otpb
Phenotype Figures
amacrine cell decreased amount, abnormal Fig. S6 from Ryu et al., 2007
brain decreased size, abnormal Fig. S6 from Ryu et al., 2007
dopaminergic neuron disorganized, abnormal Fig. S6 from Ryu et al., 2007

Phenotype of all Fish created by or utilizing MO3-otpb
Phenotype Fish Conditions Figures
brain decreased size, abnormal WT + MO3-otpb standard conditions Fig. S6 from Ryu et al., 2007
amacrine cell decreased amount, abnormal WT + MO3-otpb standard conditions Fig. S6 from Ryu et al., 2007
dopaminergic neuron disorganized, abnormal WT + MO3-otpb standard conditions Fig. S6 from Ryu et al., 2007
caudal tuberculum dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb(AB) standard conditions Fig. 2 from Ryu et al., 2007
postoptic commissure decreased size, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
hypothalamus dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4Fig. 6 from Kastenhuber et al., 2010
caudal tuberculum dopaminergic neuron absent, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4Fig. 6 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract decreased size, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 6Fig. 8 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
hypothalamus dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb(AB) standard conditions Fig. 2 from Ryu et al., 2007
anterior catecholaminergic tract decreased size, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4Fig. 6 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4Fig. 7 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4Fig. 8 from Kastenhuber et al., 2010
diencephalon dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
postoptic commissure decreased size, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
OTHER MO3-otpb MORPHOLINO PAGESNo links to external sites
CITATIONS (5)