header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070531-5
Morpholino Name: MO3-otpb
Target: otpb (1)
Sequence:
5' - GAGCAAGTTCATTAAGTCTCACCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-site-specific MO targeted to the second exon–intron boundary of the otpb gene.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-otpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-otpb
Expressed Gene Anatomy Figures
fezf2 Fig. 1 with image from Wolf et al., 2013
foxb1a Fig. 1 with image from Wolf et al., 2013
otpa Fig. 2 from Ryu et al., 2007
sim1a Fig. 5 with image from Löhr et al., 2009
sim1b Fig. 5 with image from Löhr et al., 2009
th Fig. 4Fig. 6Fig. 7Fig. 8 from Kastenhuber et al., 2010
Fig. 2Fig. S6 from Ryu et al., 2007
uts1 Fig. 7 with image from Wolf et al., 2013
vip Fig. 7 with image from Wolf et al., 2013
PHENOTYPE
Phenotype resulting from MO3-otpb
Phenotype of all Fish created by or utilizing MO3-otpb
Phenotype Fish Conditions Figures
brain decreased size, abnormal WT + MO3-otpb standard conditions Fig. S6 from Ryu et al., 2007
amacrine cell decreased amount, abnormal WT + MO3-otpb standard conditions Fig. S6 from Ryu et al., 2007
dopaminergic neuron disorganized, abnormal WT + MO3-otpb standard conditions Fig. S6 from Ryu et al., 2007
caudal tuberculum dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb(AB) standard conditions Fig. 2 from Ryu et al., 2007
postoptic commissure decreased size, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
hypothalamus dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4Fig. 6 from Kastenhuber et al., 2010
caudal tuberculum dopaminergic neuron absent, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4Fig. 6 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract decreased size, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 6Fig. 8 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
hypothalamus dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb(AB) standard conditions Fig. 2 from Ryu et al., 2007
anterior catecholaminergic tract decreased size, abnormal otpam866/m866 + MO3-otpb(AB/TL) standard conditions Fig. 4Fig. 6 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4Fig. 7 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4Fig. 8 from Kastenhuber et al., 2010
diencephalon dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
postoptic commissure decreased size, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a(AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
OTHER MO3-otpb MORPHOLINO PAGESNo links to external sites
CITATIONS (5)