ZFIN ID: ZDB-MRPHLNO-070525-6
Morpholino Name: MO1-aplnra
Target: aplnra (1)
Previous Name: MO1-agtrl1a

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTATTCCGACGTTGGCTCCATTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-aplnra No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-aplnra
Expressed Gene Anatomy Figures
myl7 Fig. 2 from Scott et al., 2007
PHENOTYPE
Phenotype resulting from MO1-aplnra
Phenotype of all Fish created by or utilizing MO1-aplnra
Genome Resources:
CITATIONS (4)